Red Cotton™ gRNA Plasmid Bank

location： Home > Products > Red Cotton™ gRNA Plasmid Bank >

EZ-editor™

Gene-eidting Series Products

With 15 years of experience, Ubigene has exclusively innovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

Request a quote Right Now!

EZ-editor™

Gene-editing Series Products

With 14 years of experience, Ubigene has exclusivelyinnovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

EZ-editor™ Gene-editing Series Products

CRISPR-iScreen™ Library

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID	Size	Price (USD)	Turnaround	Resistance	Product Name	Type of Plasmid	Catalog#	gRNA Sequence
12190	≥2ug	80	3-5(business day)	EGFP/puro/cas9	Brca2 gRNA3-gRNA4 KO plasmid	Regular Plasmid	YKO-RP003-Brca2[gRNA3-gRNA4]	ATACAATTCTGAACCTCCGG AAAGCTCCTCAAACCAATTG	Order Strategy
12305	≥2ug	80	3-5(business day)	EGFP/puro/cas9	Ddr1 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-Ddr1[gRNA1-gRNA2]	GGCAGCGGTAGAGTCCGACC TGGTGCGGTCCTGCATGCCC	Order Strategy
170472	≥2ug	80	3-5(business day)	EGFP/puro/cas9	Recql5 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-Recql5[gRNA1-gRNA2]	TTTACAAGAGAGTGCGACCA ACTCGCCGCTCCCGGTCGAA	Order Strategy
22937	≥2ug	80	3-5(business day)	EGFP/puro/cas9	SCAP gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-SCAP[gRNA1-gRNA2]	AGATGCAGAACCCTGTGAAG CTCACGCAGCCTTTCAGTCA	Order Strategy
10093	≥2ug	80	3-5(business day)	EGFP/puro/cas9	ARPC4 gRNA3-gRNA4 KO plasmid	Regular Plasmid	YKO-RP003-ARPC4[gRNA3-gRNA4]	GCCCGCACGGCACTCAGGTA ACGACACAACAAGCCGGAAG	Order Strategy
10093	≥2ug	80	3-5(business day)	EGFP/puro/cas9	ARPC4 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-ARPC4[gRNA1-gRNA2]	CCCGCACGGCACTCAGGTAG GTTGTGTCGTTCCACAACCT	Order Strategy
108062	≥2ug	80	3-5(business day)	EGFP/puro/cas9	Cstf2 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-Cstf2[gRNA1-gRNA2]	CAGCGGGAGAGCACTTCGAG TAAGTGCTGTCTCTTGGTCT	Order Strategy
987	≥2ug	80	3-5(business day)	EGFP/puro	LRBA gRNA5-gRNA6 KO plasmid	Lentiviral Plasmid	YKO-LV001-LRBA[gRNA5-gRNA6]	TTCAAGGAGATAAAGGACGA GGTTGACATGTTGGGAGTGC	Order Strategy
91746	≥2ug	80	3-5(business day)	EGFP/puro/cas9	YTHDC1 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-YTHDC1[gRNA1-gRNA2]	AGGATCCCTTTTCCGGACAC ACAAGCGTCTAGATGCTGAT	Order Strategy
84883	≥2ug	80	3-5(business day)	EGFP/puro/cas9	AIFM2 gRNA3-gRNA4 KO plasmid	Regular Plasmid	YKO-RP003-AIFM2[gRNA3-gRNA4]	GACCCTGGAGGATCCCGCCC TGGCCCGACGCTTTGGTCAA	Order Strategy

9 10 11 12 13

Product Name	Price (USD)
Brca2 gRNA3-gRNA4 KO plasmid	80	Order Strategy
Ddr1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
Recql5 gRNA1-gRNA2 KO plasmid	80	Order Strategy
SCAP gRNA1-gRNA2 KO plasmid	80	Order Strategy
ARPC4 gRNA3-gRNA4 KO plasmid	80	Order Strategy
ARPC4 gRNA1-gRNA2 KO plasmid	80	Order Strategy
Cstf2 gRNA1-gRNA2 KO plasmid	80	Order Strategy
LRBA gRNA5-gRNA6 KO plasmid	80	Order Strategy
YTHDC1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
AIFM2 gRNA3-gRNA4 KO plasmid	80	Order Strategy

9 10 11 12 13

Subscribe Us

* E-mail：

Country/Region：

Name：

By subscription, you consent to allow Ubigene Biosciences to store and process the information provided above to deliver the latest news, research spotlight, and promotions. You can unsubscribe from these communications at anytime.